https://pearlynlii.com Pearlyn Lii Mon, 03 Aug 2026 18:32:01 +0000 https://pearlynlii.com en https://pearlynlii.com/Bio Fri, 03 Jun 2022 21:28:54 +0000 Pearlyn Lii https://pearlynlii.com/Bio <img width="4096" height="2304" width_o="4096" height_o="2304" data-src="https://freight.cargo.site/t/original/i/91851ec4449276f0d3c26ae68a5375cd7ea2d7a8830e311d074c6eaf9d737555/2019_Portrait_PearlynLii.jpg" data-mid="144472743" border="0" src="https://freight.cargo.site/w/1000/i/91851ec4449276f0d3c26ae68a5375cd7ea2d7a8830e311d074c6eaf9d737555/2019_Portrait_PearlynLii.jpg" /> Pearlyn Lii (b. Hong Kong) is an interdisciplinary artist and designer based in New York with roots in Los Angeles. Lii constructs speculative mythologies that render alternative worlds as subversive ritual. Drawing on ancestral memory, cosmotechnics, the erosion of filial piety, and shifting notions of personhood, she builds fictional cosmologies that expose the fragility of techno-optimism and its entanglement with invisible power structures. Her work manifests across video game animation, sculpture, and embodied performance. Lii is an alumna of NEW INC, a cohort of artists supported by The New Museum, and is a selectee of the Art+Code track in partnership with Rhizome. There, she founded nonstudio, an art and design practice that investigates mythologies through transmedia. Her work has been presented at New York Live Arts, JO-HS, MoMA, MAXMachina, The Tech Interactive Museum, The New York Times, and covered by Vogue Italia, Wallpaper*, Art in America, Killscreen, The New River, and Casa BRUTUS. Previously, she has worked with the Guggenheim Bilbao, Whitewall Magazine, and Maison Kitsuné. She is an alumna of ArtCenter College of Design, where she earned a Bachelor of Fine Arts with Distinction, and is an MFA candidate in Moving Image at the Milton Avery Graduate School of the Arts at Bard College. Recently —Art Director, Freelance, Local Projects—Fellow, Moulin à Nef, VCCA France Previously—Fellow, Virginia Center for the Creative Arts —Artist-In-Residence, JO-HS, Mexico City —Cohort Member, NEW INC at the New Museum, Interactive Experiences,Year 6 + Art &amp; Code (with Rhizome), Year 7 Speaking—2x4—Google—New York Times —Killscreen —Parsons—ArtCenter—NEW INC x Pioneer Works&nbsp; @For all inquiries, contact hi[at]nonstud.io. https://pearlynlii.com/News Thu, 15 Jun 2023 20:06:34 +0000 Pearlyn Lii https://pearlynlii.com/News DEC 19, 2025 {Ephemera} InfiniteMother_v1.0–v2.0 Riso Edition is available on Metalabel. The artist-edition risograph booklet gathers worldbuilding fragments and reprocessed stills from the first two cutscenes of Infinite Mother, Lii’s game-based work. Featuring a debossed cover and loop staples, the edition is risographed on French Paper at Secret Riso Club. With gratitude to Danielle Paterson, Gonzalo Guerrero, and Tara Ridgedell. Photographs by Amy Li.&nbsp;{Link to collect} <img width="2476" height="1650" width_o="2476" height_o="1650" data-src="https://freight.cargo.site/t/original/i/fb0591883fe1061d000aadbcd03dd2b79007660bc3924daa41a1a29e09c5b780/Screenshot-2026-01-07-at-8.24.53AM.png" data-mid="242556800" border="0" src="https://freight.cargo.site/w/1000/i/fb0591883fe1061d000aadbcd03dd2b79007660bc3924daa41a1a29e09c5b780/Screenshot-2026-01-07-at-8.24.53AM.png" /><img width="1094" height="1648" width_o="1094" height_o="1648" data-src="https://freight.cargo.site/t/original/i/011e48d05b3bbf0fe95ccdd556126cbd36d2c26e86be31dff89f7e00968fb38d/PearlynLii_InfMoRisoEdition_photocred-AmyLi_02.png" data-mid="242557260" border="0" data-scale="100" src="https://freight.cargo.site/w/1000/i/011e48d05b3bbf0fe95ccdd556126cbd36d2c26e86be31dff89f7e00968fb38d/PearlynLii_InfMoRisoEdition_photocred-AmyLi_02.png" /> &nbsp; DEC 12, 2025 {Screening &amp; Exhibition} Underground Art and Design (UAAD), New York.&nbsp;InfiniteMother_v2.0 will be exhibiting for an evening at UAAD for Neuromantics (a nod to Gibson’s 1984 sci-fi novel Neuromancer)&nbsp;curated by Danielle Paterson and Amy Jiang. Artists include Jonah King, Chia Amisola, Cybernetics Library, Jackie Liu, Lois He, and Pearlyn Lii, amongst others. {Link} <img width="1620" height="2025" width_o="1620" height_o="2025" data-src="https://freight.cargo.site/t/original/i/e13ae6818414f0bae9a6e672025fd6aaaec20922d62fded674e4d9d21bc754e0/flyer.png" data-mid="242556751" border="0" src="https://freight.cargo.site/w/1000/i/e13ae6818414f0bae9a6e672025fd6aaaec20922d62fded674e4d9d21bc754e0/flyer.png" /> OCT 31–NOV 2, 2025{Screening &amp; Exhibition} WSA, New York. InfiniteMother_v2.0 will be exhibiting for three days at WSA for KIN: A Festival of Memory and Imagination&nbsp;curated by Kinfolk Tech. Artists include Jazsalyn, Nouf Aljowaysir, and Pearlyn Lii in the Projection Room, amongst others. Photograph by Alan Tansey.&nbsp;{Link} <img width="2000" height="1333" width_o="2000" height_o="1333" data-src="https://freight.cargo.site/t/original/i/b94d0a9d4b46ff6081ef48f620f69f61e5338b97b3435cd321c8692065d95a25/2025.10.31-Kinfolk---Infinite-Mother.jpg" data-mid="240884681" border="0" src="https://freight.cargo.site/w/1000/i/b94d0a9d4b46ff6081ef48f620f69f61e5338b97b3435cd321c8692065d95a25/2025.10.31-Kinfolk---Infinite-Mother.jpg" /> NOV 9, 2024{Screening &amp; Performance} MAXmachina, New York. The premiere of InfiniteMother_v2.0 will be screening for one night at MAXmachina for PARABLES FOR THE BIOTECH AGE, a night of live performance curated by Daniel Grushkin. Artists include Björk, Drew Berry, Heather Dewey-Hagborg, Pearlyn Lii, Sputniko!, Sue Huang, amongst others. Open to public. {Link to tickets}&nbsp;{Link to event site} <img width="4500" height="5625" width_o="4500" height_o="5625" data-src="https://freight.cargo.site/t/original/i/d76545cd9b5da95c29f00cd18743cac3dbe380173578d436720477ef9292fef8/Parables_InfiniteMother_v2.0.002.png" data-mid="221306450" border="0" src="https://freight.cargo.site/w/1000/i/d76545cd9b5da95c29f00cd18743cac3dbe380173578d436720477ef9292fef8/Parables_InfiniteMother_v2.0.002.png" /> MAY 8, 2024{Screening} The Tech Interactive, San Jose. A preview of InfiniteMother_v1.0 will be screening for one night at the The Tech’s IMAX dome for&nbsp;PARABLES FOR THE BIOTECH AGE, a night of live performance curated by Daniel Grushkin. Artists include Björk, Drew Berry, Heather Dewey-Hagborg, Pearlyn Lii, Sputniko!, Sue Huang, amongst others. Open to public. {Link to tickets} <img width="4500" height="5625" width_o="4500" height_o="5625" data-src="https://freight.cargo.site/t/original/i/79f0a107cff50099ba2137dc6be4131b3ab23f53b8492530a60088a126b0c4f7/BiodesignChallenge_Parables_SocialTemplate.png" data-mid="210307884" border="0" src="https://freight.cargo.site/w/1000/i/79f0a107cff50099ba2137dc6be4131b3ab23f53b8492530a60088a126b0c4f7/BiodesignChallenge_Parables_SocialTemplate.png" /> NOVEMBER 1, 2023I am thrilled to announce my participation as a founding artist in the launch of Gemma Projects, a curated platform and grant program for artists, by artists. I am honored to be participating in this exciting project alongside a host of other amazing creators. This year has seen the evolution of so many wonderful connections and collaborations and I am excited for what is to come with Gemma. My gratitude to Lindsay Howard and Eileen Isagon Skyers. <img width="3840" height="2160" width_o="3840" height_o="2160" data-src="https://freight.cargo.site/t/original/i/e0bddcfb75e7afad81830ad517603e9d325b1c639525c247ec6db4b354fd70f3/InfMoStill03.jpg" data-mid="195825424" border="0" src="https://freight.cargo.site/w/1000/i/e0bddcfb75e7afad81830ad517603e9d325b1c639525c247ec6db4b354fd70f3/InfMoStill03.jpg" /> From Gemma— <img width="2216" height="3000" width_o="2216" height_o="3000" data-src="https://freight.cargo.site/t/original/i/b23897e5168339f656988ae14c9fa014325305afb1acc80eb7cb440d28f0d5c4/F98pwkBXUAA9Ezl.jpeg" data-mid="195825445" border="0" src="https://freight.cargo.site/w/1000/i/b23897e5168339f656988ae14c9fa014325305afb1acc80eb7cb440d28f0d5c4/F98pwkBXUAA9Ezl.jpeg" /> OCTOBER 5, 2023{Artist Talk} Pearlyn Lii &amp; Pedro Lavin in conversation for their two-person show titled ‘Within, Below’ at Chinatown Soup (IRL) &amp;&nbsp;Distant Gallery (URL)—curated &amp; moderated by Eileen Isagon Skyers. 5:30 ET, Online.&nbsp;{Link to gallery} <img width="960" height="960" width_o="960" height_o="960" data-src="https://freight.cargo.site/t/original/i/b3bc1490d62797ff6deaf8ab3d63cd5a64ddfb082dfda6197502ffc5a46a77ae/unnamed2.jpeg" data-mid="192846096" border="0" data-scale="63" src="https://freight.cargo.site/w/960/i/b3bc1490d62797ff6deaf8ab3d63cd5a64ddfb082dfda6197502ffc5a46a77ae/unnamed2.jpeg" /><img width="960" height="960" width_o="960" height_o="960" data-src="https://freight.cargo.site/t/original/i/4c41e1351bcdc85f278c025bb75efaa715e2dabd2ee3a2f87829f4def9a8ae0f/unnamed.jpeg" data-mid="192846094" border="0" data-scale="63" src="https://freight.cargo.site/w/960/i/4c41e1351bcdc85f278c025bb75efaa715e2dabd2ee3a2f87829f4def9a8ae0f/unnamed.jpeg" /> SEPTEMBER 26, 2023{Artist Talk} New York Times: The Journey from Design to Art with Pearlyn Lii. <img width="1920" height="1080" width_o="1920" height_o="1080" data-src="https://freight.cargo.site/t/original/i/6ca913fc7452af7ec01e596c0553a0b458f36cf1f6639cd2826b3d1c9665c445/PL_NYT_2023.001.jpeg" data-mid="192050160" border="0" src="https://freight.cargo.site/w/1000/i/6ca913fc7452af7ec01e596c0553a0b458f36cf1f6639cd2826b3d1c9665c445/PL_NYT_2023.001.jpeg" /> JULY 12, 2023{Artist Talk} Google Brand Studio Presents: Identity, Mitochondrial DNA, Genetic Opera, and the Infinite Mother with Pearlyn Lii. Inaugural speaker.&nbsp;<img width="3018" height="1702" width_o="3018" height_o="1702" data-src="https://freight.cargo.site/t/original/i/e39fbf63bcda9842607d147ebf53ec346b378a8447a833ad2e0b342d8c3298b4/Screen-Shot-2023-07-08-at-9.59.25-PM.png" data-mid="184529947" border="0" src="https://freight.cargo.site/w/1000/i/e39fbf63bcda9842607d147ebf53ec346b378a8447a833ad2e0b342d8c3298b4/Screen-Shot-2023-07-08-at-9.59.25-PM.png" /> JUNE 29, 2023{Artist Conversation} Killscreen. Gaming as Performance: The Journey from Design to World-building with Pearlyn Lii. 8pm ET, Online. {Link to tickets} <img width="3208" height="2106" width_o="3208" height_o="2106" data-src="https://freight.cargo.site/t/original/i/24689d87f8799b9e67f111642b5c2197f44bb961d35252bf20cd351cdc925eda/Screen-Shot-2023-06-26-at-12.51.23-PM.png" data-mid="183325795" border="0" src="https://freight.cargo.site/w/1000/i/24689d87f8799b9e67f111642b5c2197f44bb961d35252bf20cd351cdc925eda/Screen-Shot-2023-06-26-at-12.51.23-PM.png" /> JUNE 23, 2023 Stage performance at Biodesign Challenge Summit, featuring Ani Liu and Emma Goldberg Liu. Reverb, A Genetic Opera&nbsp;@MoMA Theater, New York.<img width="4320" height="5400" width_o="4320" height_o="5400" data-src="https://freight.cargo.site/t/original/i/b51e4d44788907464cd37042e7f99f8f1d1e683dbf7087eea34a8abea1af3d76/Insta_Slide1.png" data-mid="182223100" border="0" data-scale="48" src="https://freight.cargo.site/w/1000/i/b51e4d44788907464cd37042e7f99f8f1d1e683dbf7087eea34a8abea1af3d76/Insta_Slide1.png" /> JUNE 23, 2023Panelist at Biodesign Challenge Summit—Art &amp; Design as Critique. With Jiabao Li, Devon Ward. Moderated by Andrew Scarpelli. @MoMA Theater, New York. <img width="3208" height="2106" width_o="3208" height_o="2106" data-src="https://freight.cargo.site/t/original/i/5315c9ef4a56329efc98e70d025447f441320b97869238019862bf5d510375d4/Screen-Shot-2023-06-15-at-4.11.54-PM.png" data-mid="182220064" border="0" src="https://freight.cargo.site/w/1000/i/5315c9ef4a56329efc98e70d025447f441320b97869238019862bf5d510375d4/Screen-Shot-2023-06-15-at-4.11.54-PM.png" /> JUNE 23, 2023 Group conversation with artist Ana María Millán and the Monster Monster Collective. 7pm ET. @Center for Arts, Research Alliances (CARA), New York. <img width="3208" height="2106" width_o="3208" height_o="2106" data-src="https://freight.cargo.site/t/original/i/03e5e3398170ee7d82b0083c1444e26a392b553391c128bdd167d2dceb79aca7/Screen-Shot-2023-06-15-at-6.03.21-PM.png" data-mid="182234986" border="0" src="https://freight.cargo.site/w/1000/i/03e5e3398170ee7d82b0083c1444e26a392b553391c128bdd167d2dceb79aca7/Screen-Shot-2023-06-15-at-6.03.21-PM.png" /> JANUARY 24, 2023{Featured} Honored to be featured alongside Refik Anadol, Ziyang Wu, and Kevin Heisner for magazine&nbsp;CASA Brutus. My gratitude to Masako Shiba. <img width="1080" height="1350" width_o="1080" height_o="1350" data-src="https://freight.cargo.site/t/original/i/25809c63a0619a7af87c034867eed19d6c3571f52bc8823ba5aaa29a18fc9192/343288462_989638695273972_2291601908690008628_n.jpeg" data-mid="182233383" border="0" data-scale="63" src="https://freight.cargo.site/w/1000/i/25809c63a0619a7af87c034867eed19d6c3571f52bc8823ba5aaa29a18fc9192/343288462_989638695273972_2291601908690008628_n.jpeg" /> JANUARY 24, 2023{Artist Talk} Identity in Alternate Realities at 2x4, New York. My gratitude to Paul Hoppe and Molly Ono. <img width="1284" height="1284" width_o="1284" height_o="1284" data-src="https://freight.cargo.site/t/original/i/9c35f3081d704d2c759be2ac65046e866f28c810d4013dc04ee2156e3981468c/IMG_4101.JPG" data-mid="182221463" border="0" data-scale="38" src="https://freight.cargo.site/w/1000/i/9c35f3081d704d2c759be2ac65046e866f28c810d4013dc04ee2156e3981468c/IMG_4101.JPG" /><img width="1080" height="1080" width_o="1080" height_o="1080" data-src="https://freight.cargo.site/t/original/i/c5ffa009f4d5488bb27e27a2a94cf18257c36bdc1c9ee56ca02c55129b84fa91/IMG_4100.JPG" data-mid="182221462" border="0" data-scale="38" src="https://freight.cargo.site/w/1000/i/c5ffa009f4d5488bb27e27a2a94cf18257c36bdc1c9ee56ca02c55129b84fa91/IMG_4100.JPG" /><img width="1080" height="1080" width_o="1080" height_o="1080" data-src="https://freight.cargo.site/t/original/i/b0dac20f89f996a3c908945aeef6296f6b361d864dd56aa1ebf5e6b1655388a1/IMG_4099.JPG" data-mid="182221461" border="0" data-scale="38" src="https://freight.cargo.site/w/1000/i/b0dac20f89f996a3c908945aeef6296f6b361d864dd56aa1ebf5e6b1655388a1/IMG_4099.JPG" /><img width="1080" height="1080" width_o="1080" height_o="1080" data-src="https://freight.cargo.site/t/original/i/de272e8cc24a75b460d1699cf658b16b483c185cdf1713dd7f2910219cf393dd/IMG_4098.JPG" data-mid="182221460" border="0" data-scale="38" src="https://freight.cargo.site/w/1000/i/de272e8cc24a75b460d1699cf658b16b483c185cdf1713dd7f2910219cf393dd/IMG_4098.JPG" /><img width="1080" height="1080" width_o="1080" height_o="1080" data-src="https://freight.cargo.site/t/original/i/c2ed1e7a1bd470e59594a09cc0a38a059f7d237979096d26718241f851bff570/IMG_4097.JPG" data-mid="182221458" border="0" data-scale="38" src="https://freight.cargo.site/w/1000/i/c2ed1e7a1bd470e59594a09cc0a38a059f7d237979096d26718241f851bff570/IMG_4097.JPG" /><img width="1080" height="1080" width_o="1080" height_o="1080" data-src="https://freight.cargo.site/t/original/i/c11d1bcea600fbba1877b6032e75fb140a62ae4de1b28ede919ca8be51945da5/IMG_4096.JPG" data-mid="182221457" border="0" data-scale="38" src="https://freight.cargo.site/w/1000/i/c11d1bcea600fbba1877b6032e75fb140a62ae4de1b28ede919ca8be51945da5/IMG_4096.JPG" /><img width="1080" height="1080" width_o="1080" height_o="1080" data-src="https://freight.cargo.site/t/original/i/4e440998dccbb6d06967c89f59daa53e3bb326cf8f2b1f236b3dbbdb80452a2f/IMG_4090.JPG" data-mid="182221455" border="0" data-scale="38" src="https://freight.cargo.site/w/1000/i/4e440998dccbb6d06967c89f59daa53e3bb326cf8f2b1f236b3dbbdb80452a2f/IMG_4090.JPG" /><img width="1080" height="1080" width_o="1080" height_o="1080" data-src="https://freight.cargo.site/t/original/i/34d7a5ede44951479ea564d446e7d8c3c695f4b558064382adc4d46f5e27440f/IMG_4095.JPG" data-mid="182221456" border="0" data-scale="38" src="https://freight.cargo.site/w/1000/i/34d7a5ede44951479ea564d446e7d8c3c695f4b558064382adc4d46f5e27440f/IMG_4095.JPG" /> JANUARY 16, 2023Reverb, A Genetic Opera debut performance and talk at Live Artery, New York Live Arts, Bill T. Jones/Arnie Zane Company. My gratitude to Janet Wong. <img width="1141" height="1692" width_o="1141" height_o="1692" data-src="https://freight.cargo.site/t/original/i/d2c5d1bf29873010e25cdbcca55d61c4f6c4eb8d854f0ebc7c5328c5728c9679/IMG_5040.jpg" data-mid="182222525" border="0" data-scale="61" src="https://freight.cargo.site/w/1000/i/d2c5d1bf29873010e25cdbcca55d61c4f6c4eb8d854f0ebc7c5328c5728c9679/IMG_5040.jpg" /> MARCH 23, 2022{Exhibition} ‘Real Girlfriend’ in Domesticada, at JO-HS Mexico City. Group show. My gratitude to Elisabeth Johs. <img width="885" height="885" width_o="885" height_o="885" data-src="https://freight.cargo.site/t/original/i/ff16997c2538caaa1c649ef7522c94b1b705ad21d2c47b0da9b3ce144839ea43/277038776_511757137061542_3105467894996477334_n.jpeg" data-mid="182227959" border="0" data-scale="63" src="https://freight.cargo.site/w/885/i/ff16997c2538caaa1c649ef7522c94b1b705ad21d2c47b0da9b3ce144839ea43/277038776_511757137061542_3105467894996477334_n.jpeg" /> MARCH 23, 2022{Artist in Residence} JO-HS Mexico City.&nbsp; <img width="3208" height="2106" width_o="3208" height_o="2106" data-src="https://freight.cargo.site/t/original/i/973b0003e634a7b9e38350167a5b2aa3279cde007e796ead10586216f29b0745/Screen-Shot-2023-06-15-at-5.26.03-PM.png" data-mid="182228457" border="0" src="https://freight.cargo.site/w/1000/i/973b0003e634a7b9e38350167a5b2aa3279cde007e796ead10586216f29b0745/Screen-Shot-2023-06-15-at-5.26.03-PM.png" /> OCTOBER 11, 2021{Artist Talk} Filmteractive Festival. My gratitude to Olek Cygan. MAY 19, 2021 {Presentation} Reverb, A Genetic Opera.&nbsp;Demo Day, hosted by&nbsp;NEW INC. MARCH 26, 2020{Artist Talk} NEW INC x Pioneer Works Mini Public Soap Box. With Connie Bakshi. <img width="1080" height="1080" width_o="1080" height_o="1080" data-src="https://freight.cargo.site/t/original/i/ea7c59a7a8481f694a21da9404402c096d1330ee037f5f7fea6e8fbb353b23ba/90417049_207864036976343_2476295927551131945_n.jpeg" data-mid="182224679" border="0" data-scale="75" src="https://freight.cargo.site/w/1000/i/ea7c59a7a8481f694a21da9404402c096d1330ee037f5f7fea6e8fbb353b23ba/90417049_207864036976343_2476295927551131945_n.jpeg" /> https://pearlynlii.com/Designnnn Wed, 08 Mar 2023 17:06:01 +0000 Pearlyn Lii https://pearlynlii.com/Designnnn PEARLYN LII ︎ART ︎BIO ︎INSTAGRAM ︎ 吕宝君Pearlyn Lii is a Creative Director whose work expresses narrative through typography, scenography, and installation—often merging physical and sensory experience with digital, kinetic, and code-based media. 2026 Available for freelancePreviouslyWolff OlinsWhitewall MagazineSYPartnersLocal ProjectsSelected ClientsHuman Rights FdnGuggenheim BilbaoNational Park Service Maison Kitsuné TEDx National Urban LeagueThe Emerson CollectiveEqual Justice InitiativeLegal Defense FundFashion For GoodSydney Living MuseumsPlanet Word MuseumBiodesigned Dassai ︎FASHION FOR GOOD MUSEUM ︎GUGGENHEIM BILBAO ︎BRONX MUSIC HALL INTERACTIVE EXPERIENCE ︎OSLO FREEDOM FORUM ︎DESIGN CUTTING ROOM FLOOR ︎BIODESIGNED: EDITORIAL DESIGN︎MAISON À BORDEAUX, A DIGITAL RECREATION ︎ BRIAN ENO ︎ FRINGE INTERMISSION︎DASSAI BLUE EXPERIENCE ︎HEARD SOUNDS VISUAL IDENTITY ︎ 🔒COURAGE MUSEUM IDENTITY ︎PLANET WORD MUSEUM: IMMERSIVE LANGUAGE EXPERIENCE ✺TALK—AVATAR, PERSONA, &amp; MAGICAL REALISM https://pearlynlii.com/Main Fri, 03 Jun 2022 11:19:35 +0000 Pearlyn Lii https://pearlynlii.com/Main PEARLYN LII ︎BIO ︎NEWS ︎INSTAGRAM ︎EMAIL ︎DESIGNNN︎DESIGNNNN ︎ 吕宝君Through time-based media, Lii constructs speculative mythologies that render alternative worlds as subversive ritual. Drawing on ancestral memory, cosmotechnics, the erosion of filial piety, and shifting notions of personhood, she builds fictional cosmologies that expose the fragility of techno-optimism and its entanglement with invisible power structures. Her work manifests across video game animation, sculpture, and embodied performance.2026 ︎INFINITEMOTHER_V2.0︎INFINITEMOTHER_V1.0 ︎DAUGHTER ︎ REAL GIRLFRIEND ︎ REVERB, A GENETIC OPERA ︎DAUGHTERS ︎SIDE QUESTING︎ MY BODY IS AN ARCHIVE,NOT A CAGE✺INFINITEMOTHER_V1.0–2.0 RISO EDITION {WITH METALABEL} ✺ TALK—AVATAR, PERSONA, &amp; MAGICAL REALISM https://pearlynlii.com/Reverb Fri, 03 Jun 2022 11:54:55 +0000 Pearlyn Lii https://pearlynlii.com/Reverb REVERB, A GENETIC OPERA Reverb, A Genetic Opera is a body of work expressed through a series of performances, collaborations, and new media, in which mitochondrial DNA is transposed into song, as a regenerative bridge to our matrilineage. Each performance of Reverb is an intimate experience involving a multi-relational performance between an opera singer, the invited participant, and a large audience who experience parallel expressions of a personalized soundscape scored from the participant’s DNA. Reverb is conceived as an ongoing series of sonic rituals that translate matrilineal memory into vibration and voice. Each iteration invites a different collaborator whose personal and ancestral narratives become compositional material, transforming biological data into performance. The work stages motherhood, daughterhood, and inheritance not as fixed roles but as resonant frequencies.&nbsp;Reverb functions as an embodied archive where sound becomes both grief and transmission, and where the act of listening is itself a form of kinmaking.︎New York Foundation for the Arts <img width="2870" height="1546" width_o="2870" height_o="1546" data-src="https://freight.cargo.site/t/original/i/ffa9f6d8f002c684a50f2578e6dc8cc00f842e843b5f5c2255251e07c2c52039/09_Code_Reverb_PearlynLii_Photo-KyleChang_5.png" data-mid="144431548" border="0" data-scale="100" src="https://freight.cargo.site/w/1000/i/ffa9f6d8f002c684a50f2578e6dc8cc00f842e843b5f5c2255251e07c2c52039/09_Code_Reverb_PearlynLii_Photo-KyleChang_5.png" /><img width="2240" height="1254" width_o="2240" height_o="1254" data-src="https://freight.cargo.site/t/original/i/dcc1fc48dd0e0fc5a077d9fd6dc8a5ce9db42120311e13b2c42905b600a4b53c/Screen-Shot-2022-06-03-at-8.19.43-AM.png" data-mid="144433077" border="0" src="https://freight.cargo.site/w/1000/i/dcc1fc48dd0e0fc5a077d9fd6dc8a5ce9db42120311e13b2c42905b600a4b53c/Screen-Shot-2022-06-03-at-8.19.43-AM.png" /> <img width="2880" height="1614" width_o="2880" height_o="1614" data-src="https://freight.cargo.site/t/original/i/995ed1a6f176165ee607257d198fe47ef473e5fee7f602f03faffd0a2fe86dd7/Pearlyn-Lii_1_credit-KyleChang.png" data-mid="144432775" border="0" src="https://freight.cargo.site/w/1000/i/995ed1a6f176165ee607257d198fe47ef473e5fee7f602f03faffd0a2fe86dd7/Pearlyn-Lii_1_credit-KyleChang.png" /> Ān, the Soprano—performed by Emma Goldberg Liu <img width="2880" height="1564" width_o="2880" height_o="1564" data-src="https://freight.cargo.site/t/original/i/6813c84a48d2ae2add108d510586e0996b97dfa16e48570cf7df1946e9bb60ed/09_Code_Reverb_PearlynLii_Photo-KyleChang_3.png" data-mid="144431545" border="0" src="https://freight.cargo.site/w/1000/i/6813c84a48d2ae2add108d510586e0996b97dfa16e48570cf7df1946e9bb60ed/09_Code_Reverb_PearlynLii_Photo-KyleChang_3.png" /> <img width="2876" height="1550" width_o="2876" height_o="1550" data-src="https://freight.cargo.site/t/original/i/4679748861d90a26ddd1497300e486d4654aad5c914e8f260a9a3a6d2ea8cae5/09_Code_Reverb_PearlynLii_Photo-KyleChang_4.png" data-mid="144431546" border="0" src="https://freight.cargo.site/w/1000/i/4679748861d90a26ddd1497300e486d4654aad5c914e8f260a9a3a6d2ea8cae5/09_Code_Reverb_PearlynLii_Photo-KyleChang_4.png" />Person X—participant&nbsp; <img width="2384" height="1248" width_o="2384" height_o="1248" data-src="https://freight.cargo.site/t/original/i/e431dd4033e04989c81b165b6b8abfe3af3fd071594de9f5187ad853c4ef4fca/09_Code_Reverb_PearlynLii_Photo-KyleChang.png" data-mid="144431542" border="0" src="https://freight.cargo.site/w/1000/i/e431dd4033e04989c81b165b6b8abfe3af3fd071594de9f5187ad853c4ef4fca/09_Code_Reverb_PearlynLii_Photo-KyleChang.png" /> Within the body of work, Lii’s mitochondrial DNA sequence is transposed into a genetic aria performed by a soprano. ATTCTAATTTAAACTATTCTCTGTTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAACACCGCTATGTACTTCGTACATTACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTGTAGTACATAAGAACCCAATCCACATCAAAACCCCCCCCCCATGCTTACAAGCAAGTACAGCAATCAACCTTCAACTATCACACATCACTGCAACTCCAAAGCCACCCCTCATCCACTAGGATACCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGCCCCCATGGATGACCCCCCTCAGATAGGGGTCCCTTGACACCATCCTCCGTGAAATCAATATCCCGCACAAGAGTGCTACTCTCCTCGCTCCGGGCCCATAACACTTGGGGGTAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGCCATAAAGCCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATG*** <img width="2085" height="1172" width_o="2085" height_o="1172" data-src="https://freight.cargo.site/t/original/i/a91541ce48a412445ca9cfd490cd99af189a9c1cbaf1ad04049f99d290d51038/Reverb_MoMA_Ani.png" data-mid="239407473" border="0" src="https://freight.cargo.site/w/1000/i/a91541ce48a412445ca9cfd490cd99af189a9c1cbaf1ad04049f99d290d51038/Reverb_MoMA_Ani.png" />A stage performance featuring Ani Liu, presented as part of Reverb. Invited into collaboration, Liu extends her research on reproduction and the politics of care into a live sonic ritual. On stage at MoMA NY, her biometric data—breath, pulse, and movement—is transposed into an aria that reverberates through her body as instrument. Within this shared performance, Liu’s presence folds into the Reverb continuum: a matrilineal dialogue where technology becomes a conduit for memory, and sound becomes an ancestral gesture of inheritance and release. *** A performance film featuring Michelle Millar Fisher, whose essay titled&nbsp;Childfree (Designing Motherhood, 2021) recounts her relationship to her mother, Ellie Millar. Millar’s matrilineal story resonated with this body of work as a woman, daughter, and curator who explores notions of motherhood. Michelle’s mitochondrial DNA was sequenced and transposed into an aria, performed as a daydream that takes place in her familial home as she recounts memories of her mother. ***Participants of the performance include Ani Liu, Michelle Millar Fisher, and Mary Rinaldi. Thank you to Ji Won Choi for creating the gown worn by Reverb’s soprano. Angela Bac and Jeane Kim for designing a poster and the title sequence, respectively, for Reverb. My gratitude to NEW INC, Karen Wong, Bruce Nussbaum, Paola Antontelli, Sabrina Dridje, Taüs Jafar, Salome Asega, Maddie Aleman, and Daniel Grushkin.With gratitude to&nbsp;Connie Bakshi for conceptual partnership during Reverb’s early stages, and my team Emma Goldberg Liu, Kyle Chang, Alex Darby, Jon-Luke Fillippi, Danielle McPhatter, Ryan Siciano, Drew Burrows, and Peter Fedak. Arthur Nelson and Joseph Chen are patrons. Reverb is fiscially sponsored by New York Foundation for the Arts. https://pearlynlii.com/Infinite-Mother Wed, 19 Jul 2023 19:33:30 +0000 Pearlyn Lii https://pearlynlii.com/Infinite-Mother INFINITEMOTHER_V1.0 Infinite Mother is a series of video game film shorts that deconstructs and reconstructs the role of mother in a video game world.ArtistPearlyn LiiDirectorsPearlyn LiiAlex DarbyGreg TruonoPrashast Thapan Team Rena Anakwe (As The Voice Of Insectoid), Alex Darby (Producer and Executive Producer), The Hybrid Studio (Production &amp; Post-Production), Pariah Interactive (Environment, Character Modeling, Animation, Cinematics), nonstudio (Production), Greg Truono (Editor),Taüs Jafar (Composer &amp; Sound Design) Special Thanks to Emma Goldberg Liu, Ying Zhang, Jon-Luke Fillippi <img width="2476" height="1646" width_o="2476" height_o="1646" data-src="https://freight.cargo.site/t/original/i/43ba7b32888d0682d1ef892ce73441a2bd7e1a8b3be91ec603b8db72cdc6b7fc/InfiniteMotherv1.0_GalleryView_CreditAlanTansey.png" data-mid="205684913" border="0" src="https://freight.cargo.site/w/1000/i/43ba7b32888d0682d1ef892ce73441a2bd7e1a8b3be91ec603b8db72cdc6b7fc/InfiniteMotherv1.0_GalleryView_CreditAlanTansey.png" />Pearlyn Lii. InfiniteMother_v1.0. 2023. Video installation, Chinatown Soup. Courtesy of Alan Tansey, New York. Set in a hellish dreamscape subverting the archetypal shanshui or Chinese rockery, the first cutscene from experimental video game Infinite Mother follows a reconstruction of Lii’s depraved self. Anthropomorphized into an insectoid avatar, Lii takes the viewer on a frenetic journey—in a last-ditch attempt to garner the attention of an emotionally-absent mother who busies herself over-cultivating a garden at the expense of nurturing her children. Informed by Gaea and viriditas—divine forces of nature—Infinite Mother’s verdant hellscape backdrops a persevering child who is left to contend with the unforgiving forces of Mother Nature in the absence of her mother. Guised as a fever dream, the machinima mourns lost time and the death of filial piety. The classic beauty of grottos in Chinese mountain-water landscapes is pulled down into an underworld, yet remains elapsing in broad daylight: an irreverence to Lii’s personal cosmology—a conflicting, diasporic battleground for examining the mother wound.Lii explores mother-daughter relationships by creating new media personas adapted from digital subcultures including video gaming to generate a platform for participants to experience, disentangle, and process intergenerational trauma. The mother archetype is often layered and loaded with cultural and literary tropes. In these digital worlds, Lii broadens the aperture through which to view the complexities of the mother role and how it plays out in mother-daughter relationships. Lii illuminates the decoupage of chaos and care that jumbles feelings of pain, disappointment, and gratification. <img width="1920" height="1286" width_o="1920" height_o="1286" data-src="https://freight.cargo.site/t/original/i/161513a91cc4358f609349aa936af49d416601e35f5184db480ca812f69ce035/-2024-PearlynLii-InfiniteMother_v1.0_TechMuseumSanJose_PhotoCred-MoriahTiffany.jpg" data-mid="237881448" border="0" src="https://freight.cargo.site/w/1000/i/161513a91cc4358f609349aa936af49d416601e35f5184db480ca812f69ce035/-2024-PearlynLii-InfiniteMother_v1.0_TechMuseumSanJose_PhotoCred-MoriahTiffany.jpg" />Pearlyn Lii. InfiniteMother_v1.0. 2024. Screening at the IMAX Theater at the Tech Museum, San Jose. Courtesy of Moriah Tiffany. <img width="1920" height="1080" width_o="1920" height_o="1080" data-src="https://freight.cargo.site/t/original/i/3688d53936754dffbbc43740b54569b02e2781429f8166587b9fa32c67fafb73/InfMoStills.002.jpeg" data-mid="205690068" border="0" src="https://freight.cargo.site/w/1000/i/3688d53936754dffbbc43740b54569b02e2781429f8166587b9fa32c67fafb73/InfMoStills.002.jpeg" /><img width="1920" height="1080" width_o="1920" height_o="1080" data-src="https://freight.cargo.site/t/original/i/6a37b599d05fd182a604658347cf0a8e7006ea8c2d26a466f1abad871174dd3a/InfMoStills.005.jpeg" data-mid="205690065" border="0" src="https://freight.cargo.site/w/1000/i/6a37b599d05fd182a604658347cf0a8e7006ea8c2d26a466f1abad871174dd3a/InfMoStills.005.jpeg" /> <img width="3840" height="2160" width_o="3840" height_o="2160" data-src="https://freight.cargo.site/t/original/i/4e6e95a7378d7d3d676459e3ddd3cfda14aaf464fe3b8aa5f0507237d8bceb23/InfMoStill04.jpg" data-mid="192524356" border="0" src="https://freight.cargo.site/w/1000/i/4e6e95a7378d7d3d676459e3ddd3cfda14aaf464fe3b8aa5f0507237d8bceb23/InfMoStill04.jpg" /><img width="1920" height="1080" width_o="1920" height_o="1080" data-src="https://freight.cargo.site/t/original/i/3a86bb8f0b3f59a54b77cb6f786f19ac8802d90b2b8b45b33aa2a445d658ae93/InfMoStills.001.jpeg" data-mid="205690061" border="0" src="https://freight.cargo.site/w/1000/i/3a86bb8f0b3f59a54b77cb6f786f19ac8802d90b2b8b45b33aa2a445d658ae93/InfMoStills.001.jpeg" /><img width="1920" height="1080" width_o="1920" height_o="1080" data-src="https://freight.cargo.site/t/original/i/56c579d0e33f764233a7b0d86b2bc4e31dc3d77ee2d7fc5c005a1ee3a00cef98/InfMoStill05.001.jpeg" data-mid="205685409" border="0" src="https://freight.cargo.site/w/1000/i/56c579d0e33f764233a7b0d86b2bc4e31dc3d77ee2d7fc5c005a1ee3a00cef98/InfMoStill05.001.jpeg" /><img width="1920" height="1080" width_o="1920" height_o="1080" data-src="https://freight.cargo.site/t/original/i/867937a8ec20c4aa16c1463fbdd6dcf891750b08f19c0436f531e169d7c7d56b/InfMoStills.007.jpeg" data-mid="205690063" border="0" src="https://freight.cargo.site/w/1000/i/867937a8ec20c4aa16c1463fbdd6dcf891750b08f19c0436f531e169d7c7d56b/InfMoStills.007.jpeg" /><img width="1920" height="1080" width_o="1920" height_o="1080" data-src="https://freight.cargo.site/t/original/i/d4693f4433ba367ff94fb6a850675cdaf3d285f0f80d32b8397ea05e15def56b/InfMoStills.004.jpeg" data-mid="205690066" border="0" src="https://freight.cargo.site/w/1000/i/d4693f4433ba367ff94fb6a850675cdaf3d285f0f80d32b8397ea05e15def56b/InfMoStills.004.jpeg" /><img width="1920" height="1080" width_o="1920" height_o="1080" data-src="https://freight.cargo.site/t/original/i/5f95434d91617103ace405c9a1f55dd48159e0713888fea91dc796b9c01074b5/InfMoStills.008.jpeg" data-mid="205690062" border="0" src="https://freight.cargo.site/w/1000/i/5f95434d91617103ace405c9a1f55dd48159e0713888fea91dc796b9c01074b5/InfMoStills.008.jpeg" /> Pearlyn Lii. Stills from InfiniteMother_v1.0. 2024. Screening at the IMAX Theater at the Tech Museum, San Jose. Courtesy of Moriah Tiffany. https://pearlynlii.com/Infinite-Mother-2 Sat, 30 Aug 2025 01:06:50 +0000 Pearlyn Lii https://pearlynlii.com/Infinite-Mother-2 INFINITEMOTHER_V2.0 Infinite Mother is a series of video game film shorts that deconstructs and reconstructs the role of mother in a video game world.ArtistPearlyn LiiDirectorsPearlyn LiiAlex DarbyGreg TruonoPrashast Thapan Team Alex Darby (Producer and Executive Producer), The Hybrid Studio (Production &amp; Post-Production), Pariah Interactive (Animation &amp; Production), nonstudio (Production), Greg Truono (Editor), Taüs Jafar (Composer &amp; Sound Design), Mio Ishikawa in role of ‘Mother’ (Motion Capture Performance and Choreography), and Kevin Pajarillaga in role of ‘Daughter’ (Motion Capture Performance) Infinite Mother is a series of interactive animated cutscenes that examine the mother wound through odes to ancient mythos within a video-game world. The machinima series imagines a digital haven for collective ancestral healing and revisionist matrilineal histories. The second episode, InfiniteMother v2.0, unfolds in a verdant hellscape inhabited by a persevering child left to endure the emotional absence of her mother. Set in an underworld grotto modeled after Chinese mountain-water landscapes, the narrative binds an ancient mother (Mother) and a cyborgian daughter (Daughter) to the Fetal Peach—a mirage that mirrors their fractured ideals of care and connection. At the center of their struggle, the Fetal Peach becomes both relic and reflection, symbolizing the impossible desire for reconciliation. Within this world, Daughter navigates an emotional terrain that moves from duty to frustration, grief, and, finally, a quiet release from the longing for recognition. Mother yearns to return to her youth and the beauty of her childhood home, free from the burden of motherhood. The two engage in an uncomfortable dance around the Fetal Peach–a fruit-like fetus and illusory mirror that reflects their implausible relationship ideals. As they fail to connect, they circle the Fetal Peach endlessly, eventually dissolving into the grotto walls. Rendered in a dreamlike blend of mythic imagery, InfiniteMother v2.0 blurs the boundaries between memory, fantasy, and ritual. Daughter’s increasingly frenetic gestures evolve into a language of rupture—an embodied syntax of an impossible relationship shaped by inheritance and distance. Drawing from traditions of filial piety, classical Chinese landscape painting, and the visual grammar of video games, Lii constructs a world where inherited ancestral myth and digital memory converge.<img width="2000" height="1333" width_o="2000" height_o="1333" data-src="https://freight.cargo.site/t/original/i/453bfa9e700050daefe18f6c444a01ee3f7db5709715271ae654d1cb9e6bde0e/2025.10.31-Kinfolk---Infinite-Mother.jpg" data-mid="251326092" border="0" src="https://freight.cargo.site/w/1000/i/453bfa9e700050daefe18f6c444a01ee3f7db5709715271ae654d1cb9e6bde0e/2025.10.31-Kinfolk---Infinite-Mother.jpg" />Photographed by Alan Tansey at KIN: A Festival of Memory and Imagination curated by Kinfolk Tech at WSA NY <img width="3840" height="2160" width_o="3840" height_o="2160" data-src="https://freight.cargo.site/t/original/i/b9171005669aa4cccb4b1b7d7ff33e39d19899958e5dee3e2111b95a1ca7b1f5/PearlFrame-041.jpg" data-mid="237628289" border="0" src="https://freight.cargo.site/w/1000/i/b9171005669aa4cccb4b1b7d7ff33e39d19899958e5dee3e2111b95a1ca7b1f5/PearlFrame-041.jpg" /> <img width="3840" height="2160" width_o="3840" height_o="2160" data-src="https://freight.cargo.site/t/original/i/ef177958541534337bfa570640f966f304ee2afb4e9a4989e83f44372dada96a/PearlFrame-040.jpg" data-mid="237628288" border="0" src="https://freight.cargo.site/w/1000/i/ef177958541534337bfa570640f966f304ee2afb4e9a4989e83f44372dada96a/PearlFrame-040.jpg" /> <img width="3840" height="2160" width_o="3840" height_o="2160" data-src="https://freight.cargo.site/t/original/i/25410b086b44a1877e0036240a9b68ecc5534fc0353a1e80b749d6fd6594664c/PearlFrame-035.jpg" data-mid="237628287" border="0" src="https://freight.cargo.site/w/1000/i/25410b086b44a1877e0036240a9b68ecc5534fc0353a1e80b749d6fd6594664c/PearlFrame-035.jpg" /><img width="3840" height="2160" width_o="3840" height_o="2160" data-src="https://freight.cargo.site/t/original/i/f6181b5b723cc438af70334ce3cd492c9e0cf7a06623fa50486d51dffb56d0f9/PearlFrame-027.jpg" data-mid="237628290" border="0" src="https://freight.cargo.site/w/1000/i/f6181b5b723cc438af70334ce3cd492c9e0cf7a06623fa50486d51dffb56d0f9/PearlFrame-027.jpg" /><img width="3840" height="2160" width_o="3840" height_o="2160" data-src="https://freight.cargo.site/t/original/i/74474564aadff9c61371b82e1917c65b5e5856fbb04f8c033f041c1b13af4c64/PearlynLii_4_credit-nonstudio.jpg" data-mid="237628291" border="0" src="https://freight.cargo.site/w/1000/i/74474564aadff9c61371b82e1917c65b5e5856fbb04f8c033f041c1b13af4c64/PearlynLii_4_credit-nonstudio.jpg" /><img width="3840" height="2160" width_o="3840" height_o="2160" data-src="https://freight.cargo.site/t/original/i/2cff6bd5a841229913e3a923493cdd802144daf72e5a20b9f9132c62a7354b24/PearlFrame-038.jpg" data-mid="237628292" border="0" src="https://freight.cargo.site/w/1000/i/2cff6bd5a841229913e3a923493cdd802144daf72e5a20b9f9132c62a7354b24/PearlFrame-038.jpg" /><img width="3840" height="2160" width_o="3840" height_o="2160" data-src="https://freight.cargo.site/t/original/i/a767fba98a152033de004f18aba17e5ef25724f8e0f044b5cb25585df1296fd9/PearlFrame-011.jpg" data-mid="237628293" border="0" src="https://freight.cargo.site/w/1000/i/a767fba98a152033de004f18aba17e5ef25724f8e0f044b5cb25585df1296fd9/PearlFrame-011.jpg" /> Pearlyn Lii. Stills from&nbsp;InfiniteMother_v2.0. 2025. &nbsp; https://pearlynlii.com/Real-Girlfriend Fri, 03 Jun 2022 14:33:12 +0000 Pearlyn Lii https://pearlynlii.com/Real-Girlfriend REAL GIRLFRIEND Real Girlfriend is a performance-based body of work. Conceived in AR, the videos satirize existing female archetypes created from the male gaze, representing an amalgam of women from the virtual canon.Real Girlfriend excavates the affective dissonance between imagined intimacy and mediated presence. In this performance, a projected avatar—animated through motion capture and live input—liaises with the audience in real time, embodying the tension between physical absence and virtual longing. The work reframes the ‘girlfriend’ construct as a speculative interface: a companion simultaneously uncanny and relational, designed to probe the politics of care, presence, and expectation. Real Girlfriend functions as a counterpoint to ritual gravitas—a delicate experiment in intimacy, virtual embodiment, and relational rupture across distance. <img width="1080" height="1080" width_o="1080" height_o="1080" data-src="https://freight.cargo.site/t/original/i/87970cd393795f44ae51e703ae0162dc89e59c78e3efcc664744ebb4eef19217/2021_RealGirlfriend_Altar.png" data-mid="144443039" border="0" src="https://freight.cargo.site/w/1000/i/87970cd393795f44ae51e703ae0162dc89e59c78e3efcc664744ebb4eef19217/2021_RealGirlfriend_Altar.png" />Real Girlfriend, A Pantheon&nbsp; (2022)1080 x 1080px 
 ︎Art in America <img width="5755" height="3219" width_o="5755" height_o="3219" data-src="https://freight.cargo.site/t/original/i/eb50b6b922c73232684ead669f2222f32ae19549a7e70e42740da3cb25008ebb/-2021-Huozhu-RealGirlfriend_JO-HS_PhotoCred-NicoCroes_01.jpg" data-mid="144444197" border="0" src="https://freight.cargo.site/w/1000/i/eb50b6b922c73232684ead669f2222f32ae19549a7e70e42740da3cb25008ebb/-2021-Huozhu-RealGirlfriend_JO-HS_PhotoCred-NicoCroes_01.jpg" /> <img width="5755" height="3201" width_o="5755" height_o="3201" data-src="https://freight.cargo.site/t/original/i/2961545616f468a7ccc254a022f88f07415da56712919153e34517660e891b5d/-2021-Huozhu-RealGirlfriend_JO-HS_PhotoCred-NicoCroes_02.jpg" data-mid="144444198" border="0" src="https://freight.cargo.site/w/1000/i/2961545616f468a7ccc254a022f88f07415da56712919153e34517660e891b5d/-2021-Huozhu-RealGirlfriend_JO-HS_PhotoCred-NicoCroes_02.jpg" />Huozhu, Real Girlfriend (2022) Zodiac Edition404 x 720pxSingle-channel video ‘Domesticada’ at JO-HS, Mexico CityCurated by Elisabeth Johs With gratitude to Michael Brown of Speaklow NYC, Moriah Rodriguez, Rad Mora, Leslie Chang, Alex Darby, Elisabeth Johs, Daniel Grushkin, and Victoria Stapley-Brown https://pearlynlii.com/My-Body-is-An-Archive-Not-A-Cage Fri, 03 Jun 2022 16:36:08 +0000 Pearlyn Lii https://pearlynlii.com/My-Body-is-An-Archive-Not-A-Cage NMY BODY IS AN ARCHIVE, NOT A CAGE (2022) <img width="3000" height="1324" width_o="3000" height_o="1324" data-src="https://freight.cargo.site/t/original/i/e774d1c74030302cc24c50070a6ede33d8b4272e98ae17f2f86c40de3ad3ae50/MyBodyIsAnArchive-NotACage_InstallationView.jpeg" data-mid="171038725" border="0" src="https://freight.cargo.site/w/1000/i/e774d1c74030302cc24c50070a6ede33d8b4272e98ae17f2f86c40de3ad3ae50/MyBodyIsAnArchive-NotACage_InstallationView.jpeg" /> vinyl, hair extensions, tubing, acrylic, modified air pumps426.72cm x 30.48cm x 254cm Photographed by Nicolás Croes, courtesy of nonstudio, New YorkWith extreme gratitude to JO-HS, Elena Sotos, and Jon-Luke Fillippi https://pearlynlii.com/daughter Mon, 03 Aug 2026 18:32:01 +0000 Pearlyn Lii https://pearlynlii.com/daughter daughter&nbsp; (2026) <img width="3000" height="2000" width_o="3000" height_o="2000" data-src="https://freight.cargo.site/t/original/i/ad7f40111ee24713afe4918d913c1d523140060071c948d10a0ed7a5b39a82f1/_SBB6405_3000px.jpg" data-mid="250925292" border="0" src="https://freight.cargo.site/w/1000/i/ad7f40111ee24713afe4918d913c1d523140060071c948d10a0ed7a5b39a82f1/_SBB6405_3000px.jpg" /> clay, plaster, pla 22.86cm x 20.32cm x 11.43cm Photographed by Kunning Huang With gratitude to Stephanie Davila, Faith Icecold, Nicholas Chiarella, and Jon-Luke Fillippi