REVERB, A GENETIC OPERA
Reverb, A Genetic Opera is a body of work expressed through a series of performances, collaborations, and new media, in which mitochondrial DNA is transposed into song, as a regenerative bridge to our matrilineage.
Each performance of Reverb is an intimate experience involving a multi-relational performance between an opera singer, the invited participant, and a large audience who experience parallel expressions of a personalized soundscape scored from the participant’s DNA.
Mitochondrial DNA uniquely retains genetic material that is passed only through maternal lineage. Reverb guides individuals through their matrilineal line—contemporary to the beginning of time—through notes of magical realism, connecting them to their feminine origins.
Participants of the performance include Ani Liu, Michelle Millar Fisher, and Mary Rinaldi. Thank you to Ji Won Choi for creating the gown worn by Reverb’s soprano. Angela Bac and Jeane Kim for designing a poster and the title sequence, respectively, for Reverb.
My gratitude to NEW INC, Karen Wong, Bruce Nussbaum, Paola Antontelli, Sabrina Dridje, Taüs Jafar, Salome Asega, Maddie Aleman, and Daniel Grushkin.
Special Thanks to Connie Bakshi for conceptual partnership during Reverb’s early stages, and my team Emma Goldberg Liu, Kyle Chang, Alex Darby, Jon-Luke Fillippi, Danielle McPhatter, Ryan Siciano, Drew Burrows, and Peter Fedak.
Arthur Nelson and Joseph Chen are sponsors. Reverb is fiscially sponsored by New York Foundation for the Arts—donate here.



Ān, the Soprano—performed by Emma Goldberg Liu

Person X—participant




Within the body of work, Lii’s mitochondrial DNA sequence is transposed into a genetic aria performed by a soprano.
ATTCTAATTTAAACTATTCTCTGTTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAACACCGCTATGTACTTCGTACATTACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCACCTGTAGTACATAAGAACCCAATCCACATCAAAACCCCCCCCCCATGCTTACAAGCAAGTACAGCAATCAACCTTCAACTATCACACATCACTGCAACTCCAAAGCCACCCCTCATCCACTAGGATACCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGCCCCCATGGATGACCCCCCTCAGATAGGGGTCCCTTGACACCATCCTCCGTGAAATCAATATCCCGCACAAGAGTGCTACTCTCCTCGCTCCGGGCCCATAACACTTGGGGGTAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGCCATAAAGCCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATG
***
A performance film featuring Michelle Millar Fisher, whose essay titled Childfree (Designing Motherhood, 2021) recounts her relationship to her mother, Ellie Millar. Millar’s matrilineal story resonated with this body of work as a woman, daughter, and curator who explores notions of motherhood. Michelle’s mitochondrial DNA was sequenced and transposed into an aria, performed as a daydream that takes place in her familial home as she recounts memories of her mother.